X
تبلیغات
رایتل
دوشنبه 11 بهمن‌ماه سال 1389
توسط: AZPB

نمونه سولات زیست شناسی سال چهارم دبیرستان


رمز و ضد رمز آغاز ترجمه در تریکودینا به ترتیب توسط کدام آنزیم ساخته می شوند ؟

     1( DNA پلیمراز یوکاریوتی– RNA پلیمراز III                  2( RNA پلیمراز II DNA پلیمراز یوکاریوتی

     3(  RNAپلیمراز پروکایوتی – RNA پلیمراز پروکاریوتی       4) RNA پلیمراز II RNA پلیمراز III

142- هرگاه در آزمایش نیرنبرگ فقط از دو نوع نوکلئوتید آدنین دار و یوراسیل دار استفاده می شد ، چند نوع رمز برای آمینو اسیدها پدید می آمد ؟

     1) 6                                2) 7                                3) 8                                4) 9

143- در بیماری کم خونی داسی شکل ، کدام یک در حد ژن روی داده است ؟ (در این بیماری اسید آمینه ی والین با کدون GUG جایگزین اسید آمینه ی گلوتامیک اسید با کدون GAG می شود.)

     1) تبدیل A به T                 2) تبدیل A به U                3) تبدیل T به A                 4) تبدیل U به A

144- مونومر فعال کننده و افزاینده به ترتیب کدامند ؟

     1) هر دو آمینو اسید           2)‌ آمینو اسید ، نوکلئوتید    3) هر دو نوکلئوتید              4) نوکلئوتید ، آمینو اسید

145- تنظیم بیان ژن در کدام جاندار ، بعد از ترجمه هم صورت می گیرد ؟

     1) هموفیلوس آنفلوآنزا        2) استرپتوکوکوس نومونیا    3) اشرشیا کلای                4) نوروسپورا کراسا

146- هرگاه قطعه ژنی در آدمی دارای 538 پیوند فسفو دی استر باشد ، رشته پلی پپتیدی که تحت رهبری آن ساخته می شود چند پیوند پپتیدی دارد ؟

     1) 90                              2) 89                              3) 88                               4) 87

147- کدام یک در هسته نورو گلیای آدمی دارای رمز است ؟

     1) لسیتین                       2) کوتین                          3) کراتین                          4) کیتین

148- هرگاه توالی یک رشته DNA به صورت CGTAATGCC باشد ، ملکول mRNA ای که از روی رشته مقابل آن رونویسی می شود دارای چند باز پورینی است ؟

     1) 5                                2) 4                                3) 3                                4) 2

149- هرگاه ظرف شیری را به باکتری اشرشیا کلای آلوده کنیم ، احتمال تشکیل کدام ترکیب بیشتر است ؟

     1) مهار کننده – لاکتوز                                              2) اپراتور – مهار کننده

     3) پروتئین تنظیمی – آلولاکتوز                                                                          4) RNA پلیمراز – اپراتور

150- tRNA آغازگر به ترتیب و از راست به چپ ، از کدام جایگاه وارد ریبوزوم شده و از کدام جایگاه خارج می گردد ؟

     1) P , A                           2) A , P                           3) A , A                           4) P , P

151- عوامل رونویسی در آمیب به کدام ، وصل نمی شوند ؟

     1) اپراتور                          2) توالی افزاینده                3) RNA پلیمراز                  4) راه انداز

 

 

152- در ترجمه RNA پیک مقابل ، اولین و آخرین آنتی کدونی که درون جایگاه A ریبوزوم قرار می گیرد به ترتیب و از راست به چپ کدامند ؟

CCUUUAAUGGCCUACGGCAUCGAUUAACCG

     1) AUU , AAU                  2) CUA , CGG                  3) AUU , CGG                  4)‌ CUA , UAC

153- تنوع محصولاتِ کدام RNA پلیمراز بیشتر است ؟

     1) I                                 2) III                              3) پروکاریوتی                    4) II

154- کپک نوروسپورای غیر جهش یافته قادر به ساختن کدام نمی باشد ؟

     1) فنیل اُرنیتین                  2) آرژینین                         3) بیوتین                          4) سیترولین

155- در پدیده رونویسی ژن، کدام مرحله از بقیه زودتر انجام می شود؟

     1) تشکیل پیوند های فسفودی استر                           2) شکستن پیوند های هیدروژنی

     3) اتصال هلیکاز به DNA الگو                                                                           4) اتصال آنزیم RNAپلیمراز به دو رشته DNA

 

156- اگر mRNA نابالغ در نوتروفیل دارای 3 توالی رونوشت اگزون باشد ، برای کوتاه شدن آن از راست به چپ چند پیوند فسفودی استر می شکند و تشکیل می شود ؟

     1) 4 و 2                           2) 6 و 3                           3) 2 و 4                           4) 3 و 6

157- در انتهای بخش رمز گردانِ ژن سازنده انواع RNA های ناقل کدام توالی دیده می شود ؟

     1) CCA                            2) GGT                           3)‌ UAC                            4) GGU

158- جهش در کدام یک به نسل بعد هم منتقل می گردد ؟

     1) کروموزم x در لوزالمعده    2) کروموزم y در کبد           3) کروموزم 21 در تخمک       4) کروموزم 23 در شبکیه

159- توالی راه انداز (P) دارای ....................... (جمله را کامل کنید)

     1) ریبوز بوده و رونویسی می شود .                            2) دئوکسی ریبوز بوده و رونویسی می شود .

     3 ) ریبوز بوده و رونویسی نمی شود .                         4) دئوکسی ریبوز بوده و رونویسی نمی شود .

160- کدام آنتی کدون زیر را می توان در سلول ها یافت ؟

     1) AAC                            2) ACU                            3) AUC                              4) AUU

161- RNA پلیمراز III به کدام یک وصل می شود ؟

     1) DNA دو رشته ای حلقوی                                      2) DNA دو رشته ای خطی

     3) DNA تک رشته ای خطی                                       4) DNA تک رشته ای حلقوی

163- کدام ، در مورد عامل پایان ترجمه درست نیست ؟

     1) جنس مونومر های آن آمینو اسیدی است .

     2) شناسایی رمز UAA را به عهده  دارد .

     3) در جایگاه A ریبوزوم جای می گیرد .

     4) پیوند بین آخرین tRNA موجود در جایگاه A و پلی پپتید را می شکند .

164- الگو برداری از ژن سازنده آنزیمِ تجزیه کننده اسید هموجنتیسیک به عهده کدام است ؟

     1) هلیکاز                                                               2) DNA پلیمراز یوکاریوتی

     3) RNA پلیمراز II                                                    4) RNA پلیمراز I

165- «مهار کننده» در کجا و توسط کدام ژن ساخته می شود ؟

     1) سیتوپلاسم ، تنظیمی و حلقوی                             2) هسته ، ساختاری و حلقوی

     3) سیتوپلاسم ، ساختاری و خطی                             4) هسته ، تنظیمی و خطی

166- در بین توالی های اگزون و اینترون ............. (جمله را کامل کنید)

     1) فقط دومی رو نویسی می شود .                            2) فقط قسمتی از رونوشت اولی ترجمه می گردد .

     3) فقط اولی رونویسی می شود .                              4) فقط قسمتی از رونوشت دومی ترجمه می گردد .

167- تنوع مونومرهای کدام ، بیشتر است ؟

     1) اپراتور                          2) افزاینده                        3) عامل رونویسی             4) رونوشت اینترون

168- کدام گزینه نادرست بیان شده است ؟

     1) محل برقراری پیوند پپتیدی درجایگاه A ریبوزوم است .

     2) عمل دوبازوی tRNA کمک به نگهداری این مولکول درون ریبوزوم است .

     3) اتصال زیر واحد بزرگ ریبوزوم در انتهای مرحله آغاز ترجمه روی می دهد .

     4) قند پنتوز در آنتی کدون و کدون باهم متفاوت است .

 

169- همه مولکول های tRNA ................. (جمله را کامل کنید)

     1) محصول فعالیت RNA پلیمراز III هستند .

     2) در هسته ساخته می شوند ولی در سیتوپلاسم فعالیت دارند .

     3) دارای بازوی آنتی کدونِ CCA می باشند .

     4) در نوکلئوتید آدنین دار انتهایی به آمینواسید متصل می شوند .

170- توانایی انجام کدام عمل بین هلیکاز و RNA پلیمراز مشترک می باشد ؟

     1) شکستن پیوند های هیدروژنی                               2) تشکیل پیوند های هیدروژنی

            3) شکستن پیوند های فسفودی استر         4) تشکیل پیوند های فسفودی استر